Discovery project: Avian Flu Project – An overview

December 2, 2006

Avian flu remains a continuous threat to economy and health of the Egyptian people. The following project aims to find the sequence of the latest published strains of the avian flu virus, to perform some comparative analysis of these strains, and to design proper diagnostic tools to detect viral contamination by PCR. You will also design a study to investigate differential human predisposition to bird flu: Are some individuals more vulnerable than others?

  • First, form a four-member scientific team that will work on the problem.
  • Project preparation phase: (Distribute tasks as you like between team members)
    • Find as many sequences as you can that represent avian flu cases in Egypt.
    • Using OMIM (Ask tutor what it is/ or ask Google for a faster answer!), find whether any human gene is related to bird flu. What gene?
Advertisement

Tutorial2: BLAST

December 1, 2006

1) In 2002, I have received the following DNA sequencing from the sequencing laboratory.

The letter they sent was as follows:

Dear ….,

Your sequence is ready; please notice that the last nucleotides were poor quality (noted as N)…

Your sequence:
TTCAAAAATACTAACCAGAGAGCCACTGAATCCGACTACAAGCATAGCCCCAAAAATGTGAGTAAGATTT
CGAACAATATCAAAGCTAGTATTCTCTTAAGTAACGGAAATGTTCGTAACGGCTACCTGTTTGATAGAAG
TCATTTAATAGCCGATAGCTTAGGAGGAAGACCTTTTAGAAATAATTTGATTACGGGTACCCGCACCCAA
AACGTAGGTAATAATGATCGTAAAGGTGGGATGCAGTATATTGAAAATAAAGTTTTAGATCACATTAAAA
GAAATCCTAAAGTCCATGTTTACTATAAAGCAACTCCTGTATATCAAGGATCCGAATTGCTACCTAGAGC
AGTTTTAGTGTCTGCTTTATCATCTGATGGATTTATTGACGAGACAGTTCGTGTGTTTAATAATGTAGCA
GGTTTTAATATTGATTACCAAAACGGTGGACTCTTATCTTCTACTGCTGACGTAGATATTAATAACGTTG
AAGAAAATGAAATCGAAACTACTGATGANGAGNTTTGAAGAGGGAATCGAAAACGAGCCTGACACGGATGC
ACTAAAAAAAGATAACAAAGATACTTCTTTACAAGACNNCTGTATATGTGGCAAGTAATGGGCAATCTGAT
GTATACTGGTACAACAAAGACAGTATGCCTAAAACTGTAAACTTAGAGAAAGTTGTAGAAATGAGTGAAC
AAGTAGCTTTGACTAGAGCTTAAACATCNNTCAACTCAAGAAAATATAGAATAA

This gene sequence was from a the Streptococcus pyogenes M1 Strain. However, I was surprised when I performed BLAST- It seemd that this protein was a new allele of a known family of proteins not but, in 2002 it was the first time to be found in M1.

Using BLAST, find out why I was surprised.

Bioi 7711 readings:


Tutorial 1 – First set of training exercises.

December 1, 2006

1) Exercise for two-students teams: Student 1 will use NCBI Entrez then RefSeq to find the sequence of streptokinase protein. Student 2 will find the same protein in the SwissProt database. Discuss the main differences you noticed between the two databases.

2) Find the sequence of hemagglutinin protein of the most recently sequenced avian flu strain. From the protein sequence, find the sequence of the gene.

3) Using Entrez, find the most recent gene published in an Egyptian institution.

4) Student 1: Using Entrez Structure, find three structures of three different proteins published by Dr. Shehab Ismail after 2005. How many proteins are bacterial? Can you find the values of the resolution in each case? Student 2: Try to perform the same search using EBI SRS structure Are there any differences in the results? Discuss which display of results you prefer.

5)


Hello world!

November 29, 2006

This weblog will allow  the communication between instructors, students and trainees during the workshops on bioinformatics and systems biology.

We hope that the blog will be a part of our future EGYBIO website.