Tutorial2: BLAST

1) In 2002, I have received the following DNA sequencing from the sequencing laboratory.

The letter they sent was as follows:

Dear ….,

Your sequence is ready; please notice that the last nucleotides were poor quality (noted as N)…

Your sequence:
TTCAAAAATACTAACCAGAGAGCCACTGAATCCGACTACAAGCATAGCCCCAAAAATGTGAGTAAGATTT
CGAACAATATCAAAGCTAGTATTCTCTTAAGTAACGGAAATGTTCGTAACGGCTACCTGTTTGATAGAAG
TCATTTAATAGCCGATAGCTTAGGAGGAAGACCTTTTAGAAATAATTTGATTACGGGTACCCGCACCCAA
AACGTAGGTAATAATGATCGTAAAGGTGGGATGCAGTATATTGAAAATAAAGTTTTAGATCACATTAAAA
GAAATCCTAAAGTCCATGTTTACTATAAAGCAACTCCTGTATATCAAGGATCCGAATTGCTACCTAGAGC
AGTTTTAGTGTCTGCTTTATCATCTGATGGATTTATTGACGAGACAGTTCGTGTGTTTAATAATGTAGCA
GGTTTTAATATTGATTACCAAAACGGTGGACTCTTATCTTCTACTGCTGACGTAGATATTAATAACGTTG
AAGAAAATGAAATCGAAACTACTGATGANGAGNTTTGAAGAGGGAATCGAAAACGAGCCTGACACGGATGC
ACTAAAAAAAGATAACAAAGATACTTCTTTACAAGACNNCTGTATATGTGGCAAGTAATGGGCAATCTGAT
GTATACTGGTACAACAAAGACAGTATGCCTAAAACTGTAAACTTAGAGAAAGTTGTAGAAATGAGTGAAC
AAGTAGCTTTGACTAGAGCTTAAACATCNNTCAACTCAAGAAAATATAGAATAA

This gene sequence was from a the Streptococcus pyogenes M1 Strain. However, I was surprised when I performed BLAST- It seemd that this protein was a new allele of a known family of proteins not but, in 2002 it was the first time to be found in M1.

Using BLAST, find out why I was surprised.

Bioi 7711 readings:

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google+ photo

You are commenting using your Google+ account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

%d bloggers like this: