Bioinformatics and the epidemiology of Influenza A

December 9, 2006

A very recent and very powerful study was recently published in the open-access journal: PLOS Pathogens, one of the top journals on Microbiology and Infectious disesases…

Stochastic Processes Are Key Determinants of Short-Term Evolution in Influenza A Virus

The article is not very easy and is full of terms that need background knowledge, but you should get a good idea on the work from the Abstract (Synopsis) and Introduction.


Bioinformatics for vaccine development

December 6, 2006

Most of you asked for more/better examples that show how bioinformatics alone can lead to discovery and practical applications.
Here is one paperĀ  IĀ  found: In silico and microarray-based genomic approaches to identifying potential vaccine candidates against Leptospira interrogans.


Course evaluation

December 5, 2006

Please remember to turn in the course evaluation forms (filled).


Literature Mining Tools

December 5, 2006

We have discussed today two different literature-mining tools.

1) PubMed Reminer: Detailed analysis of PubMed search results.

PubReMiner will query pubmed with your specified searchquery, get all abstracts and generate frequency tables.
The first table will show you journals in which your query is published the most.
The second table will show you the authors which are most active in the field of your query.
The third table will show you words that have been used most in the title and abstract of the articles.
furthermore, Addressfields, MESH headers and publication year are displayed.
All elements can be added to your query, and will thus make sure that your refinement still generates results.
When you are satisfied with the query, you can jump to pubmed and view the results.
Alternative names: PubReMiner, pubmed reminer, pub reminer, pubmed re-miner

2) Chilibot! The smart literature miner…

Find relationships from PubMed abstracts…


Tutorial 4: Peptide fingerprinting questions

December 4, 2006

A- Use Aldente or MS-Fit to identify the following proteins.

  1. A protein that was identified on a 2D-gel with an approximate MW of 35 kDa and an isoelectric point of 8.4.
    After trypsin digestion and MS analysis, the following masses were obtained:

    1261.59
    1211.4
    1111.64
    963.48
    950.49
    871.54
    842.54
    751.5
    721.354
    609.33

  2. During a co-immunoprecipitation experiment (what is it?), a protein with a MW around 50 kDa and pI about 5, was identified to bind to HSP 60.
    The peptide fingerprinting results were as follow:

    1272.24
    702.352
    645.36
    1076.5
    1115.7
    861.32
    1169.7
    1323.6
    1471.2
    1405.7
    1588.644

    There was a closely related form of the protein with the following, slightly different peptide masses:

    872.41
    702.352
    645.36
    1076.5
    1115.7
    701.39
    1169.7
    1323.6
    1471.2
    1405.7
    1428.7117

    Identify the protein and explain the slight differences in MS results.

  3. Have you noticed differences between Aldente and MS-FIT? Discuss the differences…
  4. How does the choice of search database affect peptide fingerprinting results?

Tutorial 3/2: ClustalW

December 3, 2006

1) Retrieve the sequence of the following proteins from Streptococcus pyogenes: SpeA (Streptococcal pyrogenic exotoxin A), SpeC, SpeG, SpeJ, and SmeZ (Streptococcal mitogenic exotoxin Z). All these proteins are streptococcal toxins with superantigenic properties.

2) Put all sequences in FASTA format (in a Word file). Modify the FASTA identifier line (i.e., the line starting with >) so that it only contains the protein symbol (This will make the following steps easier).

3) Use either NPS@ or EBI ClustalW (Both sites are linked in the side bar under “Blogroll”) to align all the five toxins.

4) Discuss with your colleague whether you can guess the active site of these superantigenic toxins from the multiple sequence alignment. To verify your answer or support your claim, search Pubmed and find whether anybody has worked on conserved residues in superantigens.


Discovery project: Avian Flu Project – An overview

December 2, 2006

Avian flu remains a continuous threat to economy and health of the Egyptian people. The following project aims to find the sequence of the latest published strains of the avian flu virus, to perform some comparative analysis of these strains, and to design proper diagnostic tools to detect viral contamination by PCR. You will also design a study to investigate differential human predisposition to bird flu: Are some individuals more vulnerable than others?

  • First, form a four-member scientific team that will work on the problem.
  • Project preparation phase: (Distribute tasks as you like between team members)
    • Find as many sequences as you can that represent avian flu cases in Egypt.
    • Using OMIM (Ask tutor what it is/ or ask Google for a faster answer!), find whether any human gene is related to bird flu. What gene?

Tutorial2: BLAST

December 1, 2006

1) In 2002, I have received the following DNA sequencing from the sequencing laboratory.

The letter they sent was as follows:

Dear ….,

Your sequence is ready; please notice that the last nucleotides were poor quality (noted as N)…

Your sequence:
TTCAAAAATACTAACCAGAGAGCCACTGAATCCGACTACAAGCATAGCCCCAAAAATGTGAGTAAGATTT
CGAACAATATCAAAGCTAGTATTCTCTTAAGTAACGGAAATGTTCGTAACGGCTACCTGTTTGATAGAAG
TCATTTAATAGCCGATAGCTTAGGAGGAAGACCTTTTAGAAATAATTTGATTACGGGTACCCGCACCCAA
AACGTAGGTAATAATGATCGTAAAGGTGGGATGCAGTATATTGAAAATAAAGTTTTAGATCACATTAAAA
GAAATCCTAAAGTCCATGTTTACTATAAAGCAACTCCTGTATATCAAGGATCCGAATTGCTACCTAGAGC
AGTTTTAGTGTCTGCTTTATCATCTGATGGATTTATTGACGAGACAGTTCGTGTGTTTAATAATGTAGCA
GGTTTTAATATTGATTACCAAAACGGTGGACTCTTATCTTCTACTGCTGACGTAGATATTAATAACGTTG
AAGAAAATGAAATCGAAACTACTGATGANGAGNTTTGAAGAGGGAATCGAAAACGAGCCTGACACGGATGC
ACTAAAAAAAGATAACAAAGATACTTCTTTACAAGACNNCTGTATATGTGGCAAGTAATGGGCAATCTGAT
GTATACTGGTACAACAAAGACAGTATGCCTAAAACTGTAAACTTAGAGAAAGTTGTAGAAATGAGTGAAC
AAGTAGCTTTGACTAGAGCTTAAACATCNNTCAACTCAAGAAAATATAGAATAA

This gene sequence was from a the Streptococcus pyogenes M1 Strain. However, I was surprised when I performed BLAST- It seemd that this protein was a new allele of a known family of proteins not but, in 2002 it was the first time to be found in M1.

Using BLAST, find out why I was surprised.

Bioi 7711 readings:


Tutorial 1 – First set of training exercises.

December 1, 2006

1) Exercise for two-students teams: Student 1 will use NCBI Entrez then RefSeq to find the sequence of streptokinase protein. Student 2 will find the same protein in the SwissProt database. Discuss the main differences you noticed between the two databases.

2) Find the sequence of hemagglutinin protein of the most recently sequenced avian flu strain. From the protein sequence, find the sequence of the gene.

3) Using Entrez, find the most recent gene published in an Egyptian institution.

4) Student 1: Using Entrez Structure, find three structures of three different proteins published by Dr. Shehab Ismail after 2005. How many proteins are bacterial? Can you find the values of the resolution in each case? Student 2: Try to perform the same search using EBI SRS structure Are there any differences in the results? Discuss which display of results you prefer.

5)


Follow

Get every new post delivered to your Inbox.